Question: The following is the template strand of the DNA. Give the mRNA sequence as well as the polypeptide chain showing each amino: TACGGTCTACGGTAGGTTCCGATT
My guess for the mRNA sequence is: AUGCCAGAUGCCAUCCAAGGUAA
Is that the right idea? I'm really not to sure how to show the polypeptide chain.
Any guidance would be appreciated! Thanks :)
My guess for the mRNA sequence is: AUGCCAGAUGCCAUCCAAGGUAA
Is that the right idea? I'm really not to sure how to show the polypeptide chain.
Any guidance would be appreciated! Thanks :)
-
Your teacher needs to mark directionality of the DNA strand, so that the correct answer won't be marked wrong. Kick your teacher once. My name is James. It is not Semaj. See the difference? Directionality is important.
So let's fix the question.
3'-TACGGTCTACGGTAGGTTCCGATT-5' (template strand DNA)
5'-AUGCCAGAUGCCAUCCAAGGCUAA-3' (mRNA)
Your sequence was close but you missed one base. That's easy to do if you're not using a fixed-space font where things line up nicely. (This font sucks for math and science).
Your next step is to look for the start codon 5'-AUG-3', then starting there, break your mRNA into codons, thus:
5'-AUG CCA GAU GCC AUC CAA GGC UAA-3' (mRNA)
Now you look up the codons on a handy dandy genetic code table.
http://en.wikipedia.org/wiki/Genetic_cod…
Met-Pro-Asp-Ala-Ile-Gln-Gly
Note: UAA is a stop codon and does not translate to an amino acid residue.
Note: Isoleucine is ILE. With this font, an uppercase i looks like a lowercase L. Did I mention that this font sucks for math and science?
So let's fix the question.
3'-TACGGTCTACGGTAGGTTCCGATT-5' (template strand DNA)
5'-AUGCCAGAUGCCAUCCAAGGCUAA-3' (mRNA)
Your sequence was close but you missed one base. That's easy to do if you're not using a fixed-space font where things line up nicely. (This font sucks for math and science).
Your next step is to look for the start codon 5'-AUG-3', then starting there, break your mRNA into codons, thus:
5'-AUG CCA GAU GCC AUC CAA GGC UAA-3' (mRNA)
Now you look up the codons on a handy dandy genetic code table.
http://en.wikipedia.org/wiki/Genetic_cod…
Met-Pro-Asp-Ala-Ile-Gln-Gly
Note: UAA is a stop codon and does not translate to an amino acid residue.
Note: Isoleucine is ILE. With this font, an uppercase i looks like a lowercase L. Did I mention that this font sucks for math and science?
-
Your mRNA sequencd is correct. The whole idea is that when transcribing, Adenine is usually transcribed to give uridine and guanine is transcribed to cytosine and vice versa but it seems you missed one base because your DNA strand was 24 base while your mRNA was 23 base. So the mRNA strand is AUGCCAGAUGCCAUCCAAGGCUAA
As for the sequence of amino acid you will need the genetic code to be able to translate the mRNA to a sequence of protein, and luckily i have one with me right now.
So the sequence of amino acid will be
Methionine, proline, Asparagine, alanine, isoleucine proline, glycine, stop.
Always remenber that methionine is a start codon.
Hope it helps
As for the sequence of amino acid you will need the genetic code to be able to translate the mRNA to a sequence of protein, and luckily i have one with me right now.
So the sequence of amino acid will be
Methionine, proline, Asparagine, alanine, isoleucine proline, glycine, stop.
Always remenber that methionine is a start codon.
Hope it helps
-
To determine the amino acid sequence, you need a table of the genetic code. Just start with AUG as the first codon, and look that up. AUG codes for Met (methionine). Just go three bases at a time, looking up each mRNA codon in turn.
-
the mRNA sequence is right.
polypetide chain: Val,Thr,Stop,Pro,Leu,Asn,Arg,Asn
polypetide chain: Val,Thr,Stop,Pro,Leu,Asn,Arg,Asn